roche lightcycler nano instrument (Roche)
Roche manufactures this product 
99
Structured Review
Roche
roche lightcycler nano instrument
Roche Lightcycler Nano Instrument, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/roche+lightcycler+nano+instrument/LightCycler+480+System/us12545922-114-28-28
Average 99 stars, based on 6 article reviews
Roche Lightcycler Nano Instrument, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/roche+lightcycler+nano+instrument/LightCycler+480+System/us12545922-114-28-28
Average 99 stars, based on 6 article reviews
roche lightcycler nano instrument - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Quantitative RT-PCR:Article Title: Examining the levels of acetylation, DNA methylation and phosphorylation in HIV-1 positive and multidrug-resistant TB-HIV patients. Article Snippet: .. The RT-qPCR amplifications were carried out using the Jo ur na l P re -p r of Article Title: Expression analysis of miRNAs and their targets related to salt stress in Solanum lycopersicum H-2274 Article Snippet: .. RT-qPCR analyses were carried out using 2X SYBR Green Mix (HibriGen, 0120-UB-756) with Article Title: Expression analysis of miRNAs and their targets related to salt stress in Solanum lycopersicum H-2274 Article Snippet: .. Primers Sequences ath-miR398a-5p 5’GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGTGTT3’ ath-miR845a 5’GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCATCAA3’ ath-miR170-5p 50GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCTGAG3’ sly-miR395a 50GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGAGTT30 sly-miR171a 5’GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGATATT3’ sly-miR156a 5’GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGTGCTC3’ RT-qPCR analyses were carried out using 2X SYBR Green Mix with Polymerase Chain Reaction:Article Title: Ellagic acid inhibits RANKL-induced osteoclast differentiation by suppressing the p38 MAP kinase pathway. Article Snippet: .. PCR products were amplified using KAPA SYBR FAST qPCR Kit Master Mix on a Article Title: Composition for promoting plant growth comprising YxaL protein or homologous protein thereof, and method for mass production of YxaL protein Article Snippet: Chemiluminescent images were acquired using a ChemiDoc XRS image analyzer (Bio-Rad, Hercules, USA), and images were processed using Molecular Dynamics ImageQuant software version 5.2 (GE Healthcare Life Science). .. cDNA was synthesized using a QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) and quantitative PCR (qPCR) was performed using a Qiagen QuantiTect SYBR Green PCR Kit with a Amplification:Article Title: Ellagic acid inhibits RANKL-induced osteoclast differentiation by suppressing the p38 MAP kinase pathway. Article Snippet: .. PCR products were amplified using KAPA SYBR FAST qPCR Kit Master Mix on a Article Title: Epigenetic changes of <i>Arabidopsis</i> MET1 cytosine methyltransferase mutants under salt stress Article Snippet: In this study, we investigated the morphological and molecular responses of Arabidopsis met1-7 and met1-3 mutants under salinity stress.. Global DNA methylation changes of mutants were compared and genes known to be involved in DNA methylation in plants were analyzed.. Also, the expression of the telomerase reverse transcriptase (TERT) gene as a stress response indicator was analyzed in order to examine the effects of stress on the telomerase enzyme in the mutants. Article Title: Examining the levels of acetylation, DNA methylation and phosphorylation in HIV-1 positive and multidrug-resistant TB-HIV patients. Article Snippet: .. Amplification reactions were performed using the Real-time Polymerase Chain Reaction:Article Title: Ellagic acid inhibits RANKL-induced osteoclast differentiation by suppressing the p38 MAP kinase pathway. Article Snippet: .. PCR products were amplified using KAPA SYBR FAST qPCR Kit Master Mix on a Article Title: Epigenetic changes of <i>Arabidopsis</i> MET1 cytosine methyltransferase mutants under salt stress Article Snippet: In this study, we investigated the morphological and molecular responses of Arabidopsis met1-7 and met1-3 mutants under salinity stress.. Global DNA methylation changes of mutants were compared and genes known to be involved in DNA methylation in plants were analyzed.. Also, the expression of the telomerase reverse transcriptase (TERT) gene as a stress response indicator was analyzed in order to examine the effects of stress on the telomerase enzyme in the mutants. Article Title: Composition for promoting plant growth comprising YxaL protein or homologous protein thereof, and method for mass production of YxaL protein Article Snippet: Chemiluminescent images were acquired using a ChemiDoc XRS image analyzer (Bio-Rad, Hercules, USA), and images were processed using Molecular Dynamics ImageQuant software version 5.2 (GE Healthcare Life Science). .. cDNA was synthesized using a QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) and quantitative PCR (qPCR) was performed using a Qiagen QuantiTect SYBR Green PCR Kit with a SYBR Green Assay:Article Title: Epigenetic changes of <i>Arabidopsis</i> MET1 cytosine methyltransferase mutants under salt stress Article Snippet: In this study, we investigated the morphological and molecular responses of Arabidopsis met1-7 and met1-3 mutants under salinity stress.. Global DNA methylation changes of mutants were compared and genes known to be involved in DNA methylation in plants were analyzed.. Also, the expression of the telomerase reverse transcriptase (TERT) gene as a stress response indicator was analyzed in order to examine the effects of stress on the telomerase enzyme in the mutants. Article Title: Composition for promoting plant growth comprising YxaL protein or homologous protein thereof, and method for mass production of YxaL protein Article Snippet: Chemiluminescent images were acquired using a ChemiDoc XRS image analyzer (Bio-Rad, Hercules, USA), and images were processed using Molecular Dynamics ImageQuant software version 5.2 (GE Healthcare Life Science). .. cDNA was synthesized using a QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) and quantitative PCR (qPCR) was performed using a Qiagen QuantiTect SYBR Green PCR Kit with a Article Title: Expression analysis of miRNAs and their targets related to salt stress in Solanum lycopersicum H-2274 Article Snippet: .. RT-qPCR analyses were carried out using 2X SYBR Green Mix (HibriGen, 0120-UB-756) with Article Title: Expression analysis of miRNAs and their targets related to salt stress in Solanum lycopersicum H-2274 Article Snippet: .. Primers Sequences ath-miR398a-5p 5’GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGTGTT3’ ath-miR845a 5’GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCATCAA3’ ath-miR170-5p 50GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCTGAG3’ sly-miR395a 50GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGAGTT30 sly-miR171a 5’GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGATATT3’ sly-miR156a 5’GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGTGCTC3’ RT-qPCR analyses were carried out using 2X SYBR Green Mix with Synthesized:Article Title: Composition for promoting plant growth comprising YxaL protein or homologous protein thereof, and method for mass production of YxaL protein Article Snippet: Chemiluminescent images were acquired using a ChemiDoc XRS image analyzer (Bio-Rad, Hercules, USA), and images were processed using Molecular Dynamics ImageQuant software version 5.2 (GE Healthcare Life Science). .. cDNA was synthesized using a QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) and quantitative PCR (qPCR) was performed using a Qiagen QuantiTect SYBR Green PCR Kit with a Reverse Transcription:Article Title: Composition for promoting plant growth comprising YxaL protein or homologous protein thereof, and method for mass production of YxaL protein Article Snippet: Chemiluminescent images were acquired using a ChemiDoc XRS image analyzer (Bio-Rad, Hercules, USA), and images were processed using Molecular Dynamics ImageQuant software version 5.2 (GE Healthcare Life Science). .. cDNA was synthesized using a QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany) and quantitative PCR (qPCR) was performed using a Qiagen QuantiTect SYBR Green PCR Kit with a Negative Control:Article Title: Examining the levels of acetylation, DNA methylation and phosphorylation in HIV-1 positive and multidrug-resistant TB-HIV patients. Article Snippet: .. Amplification reactions were performed using the Control:Article Title: Prostaglandin E2 promotes human cholangiocarcinoma cell proliferation, migration and invasion through the upregulation of β-catenin expression via EP3-4 receptor. Article Snippet: .. The primer sequences used were: EP3-4R, 5'-TGC ATCCAGCTCCACCTCCT-3' (forward) and 5'-GCAAAT TCAGGGAAGCAGGAATTGC-3' (reverse); EP3-5R, 5'-TGT TCGCCTGGCTTCACTGAACC-3' (forward) and 5'-AGA GCAGCTGGAGACAGCATTTGC-3' (reverse); EP3-6R, 5'-TGTTCGCCTGGCTTCACTGAACC-3' (forward) and 5'-TGTGATCCTGGCAGAAAGGCAGG-3' (reverse); EP3-7R, 5'-TGTGATCCTGGCAGAAAGGCAGG-3' (forward) and 5'-TTTGGGAGGTGGGTGTTTCTGTGA' (reverse); c-Myc, 5'-AGGCTATTCTGCCCATTT-3' (forward) and 5'-TCGTAGTCGAGGTCATAGTTC-3' (reverse); Snail, 5'-AAGGACCACCGCATCTCTAC-3' (forward) and 5'-CC AGCTCCTTGAAGCAGAAGA-3' (reverse); β-catenin, 5'-GC CAAGTGGGTGGTATAGAG-3', (forward) and 5'-TGGGAT GGTGGGTGTAAG-3' (reverse); GAPDH, 5'-TTCCAGGAG CGAGATCCCT-3' (forward) and 5'-CACCCATGACGAA CATGGG-3' (reverse). qPCR analysis was performed on a |